Puc18 sequence pdf worksheet

[jasjvxbParticipant]

.
.

Puc18 sequence pdf worksheet >> DOWNLOAD

Puc18 sequence pdf worksheet >> READ ONLINE

.
.
.
.
.
.
.
.
.
.

puc 18/19

puc18 vector biology discussion

puc18 restriction enzymes

puc18 and puc19 difference

puc18 diagram

puc18 vector notes

puc18 copy numberpuc18 transformation

PUC18/19 Vector Map. Multiple cloning Sites of puc18: Hindlil. Pael Sdal al. Bevi Sall. Hincll pUC18 Sequence (2686 bp). 1 TCGCGCGTTT CGGTGATGAC
pUC18/19 have been constructed using the ampicillin resistance gene and origin of Therefore, the plasmid DNA is ready-to-use for enzymatic reactions and.
Product Name. D4154. pUC18 Plasmid DNA. D3404. pUC19 Plasmid DNA. pUC18 and pUC19 Plasmids confer resistance to for each plasmid is within the ?-galactosidase gene and Safety Data Sheet for information regarding hazards.
Vector backbone, pUC18 (Plasmid) RDB03436, pUC18-HTK (with promoter), DNA solution, 8,440 JPY plus shipping Test sheet, RDB13745_A7Kap1.pdf
puc18; Plasmid DNA from Escherichia coli RRI has been used in polymerase Specification Sheet (PDF) PSF-CMV-PUC18 – CMV PUC18 MCS PLASMID.
GenBank · SnapGene; File Help. > pUC18 sequence 2686 bps tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtct
Thermo Scientific pUC18 vector is a small, high copy number, E. It contains identical multiple cloning site (MCS) as pUC19 vector except that it is arranged in opposite orientation. For pUC18 DNA sequence, pUC19 DNA sequence, sequence analysis and map creation, see free online
pUC18. Standard E. coli vector with a multiple cloning site (MCS) for DNA cloning To see this sequence with restriction sites, features, and translations, please
ii) If the DNA shown above was cut with BclI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. d).

[Author]

Posts